...
| No Format |
|---|
#PBS -m abe #PBS -M <youremail>@griffith.edu.au #PBS -N qiimeOpenMPI #PBS -l select=2:ncpus=3:mem=12g:mpiprocs=3 source $HOME/.bashrc module load qiime/1.3.0 WORK_DIR=/export/home/snumber/pbs/qiime HOME_DIR=/export/home/snumber/ echo "Starting job" ## The number of nodes is given by the select =<NUM > above NODES=1 ###$PBS_NODEFILE is a node-list file created with select and mpiprocs options by PBS ###### The number of MPI processes available is mpiprocs * nodes (=NPROCS) NPROCS=6 mpirun --prefix /sw/openMPI/1.4.3-gnu/ -machinefile $PBS_NODEFILE -np $NPROCS env PATH=$PATH:$SWORK_DIR:$HOME_DIR env LD_LIBRARY_PATH=$LD_LIBRARY_PATH make_otu_heatmap_html.py -i otus/otu_table.txt -o otus/OTU_Heatmap/ echo "Done with job" |
Another Sample PBS script
| No Format |
|---|
#!/bin/bash
#PBS -N QIIME
#PBS -m abe
#PBS -M YourEmail@griffith.edu.au
#PBS -l select=1:ncpus=2:mem=14gb -l walltime=100:00:00
module load qiime/1.5.0
export FEKO_USER_HOME=/export/home/s12345/pbs/feko
source $HOME/.bashrc
echo "Starting job: "
pick_otus_through_otu_table.py -i /export/home/s12345/pbs/qiime/seq.fasta -o /export/home/s12345/pbs/qiime/otus/ |
An example seq.fasta file
| No Format |
|---|
>34
TGGCACGTGCGATGGCAGTTCAACGTTCA
>23
TAAATCCCGTAGGCTTTTAGCATCGACG
>2
TTATTCGAAGCGCTTTACGACACGCGCGCA |
Version 1.5.0
Usage
| No Format |
|---|
module load qiime/1.5.0 OR: module load python/2.7.1 module load qiime/1.3.0 module load bioinformatics/uclust/1.2.22 module load bioinformatics/fasttree/2.1.3 module load bioinformatics/rdpclassifier/2.3 module load R/2.13.0 module load blast/2.2.25 module load bioinformatics/cd-hit/4.5.4 module load bioinformatics/cdbfasta/0.99 module load bioinformatics/chimeraslayer/r20110519 module load bioinformatics/mothur/1.21.1 module load bioinformatics/clearcut/1.0.9 module load bioinformatics/raxml/7.2.8a-mpi #(other versions available) module load bioinformatics/infernal/1.0.2-mpi #(OR module load bioinformatics/infernal/1.0.2-serial) module load bioinformatics/mafft/6.857 # (OR: module load bioinformatics/mafft/6.857-extensions) module load bioinformatics/muscle/3.8.31 module load gsl/gsl-1.15 module load bioinformatics/greengenes/gg module load bioinformatics/ampliconnoise/1.25 module load bioinformatics/ghc/7.0.3 module load cytoscape/2.8.1 module load mpi/openMPI/1.4.3-gnu #(optional) module load qiime/1.5.0 |
...