cat ~/.qiime_config
# qiime_config
# WARNING: DO NOT EDIT OR DELETE Qiime/qiime_config
# To overwrite defaults, copy this file to $HOME/.qiime_config or a full path
# specified by $QIIME_CONFIG_FP and edit that copy of the file.

cluster_jobs_fp /sw/qiime/Qiime/1.5.0/bin/start_parallel_jobs.py
python_exe_fp   python
working_dir
blastmat_dir    /sw/bioinformatics/ncbi/2009.3/ncbi/data
blastall_fp     blastall
pynast_template_alignment_fp    /sw/qiime/greengenes/core_set_aligned.fasta.imputed
pynast_template_alignment_blastdb
template_alignment_lanemask_fp  /sw/qiime/greengenes/lanemask_in_1s_and_0s
jobs_to_start   1
seconds_to_sleep        60
qiime_scripts_dir       /sw/qiime/Qiime/1.5.0/bin
#qiime_scripts_dir      /sw/qiime/Qiime/1.5.0/bin
temp_dir        /tmp
denoiser_min_per_core   50
cloud_environment       False
topiaryexplorer_project_dir
torque_queue    workq
sc_queue      all.q
topiaryexplorer_project_dir
assign_taxonomy_reference_seqs_fp
qiime_test_data_dir

module load qiime/1.5.0
module load qiime/1.9.1 

module load qiime/1.5.0
print_qiime_config.py -t

 print_qiime_config.py -t

System information
==================
         Platform:      linux2
   Python version:      2.7.1 (r271:86832, Jun 29 2011, 09:08:45)  [GCC 4.4.5 20110214 (Red Hat 4.4.5-6)]
Python executable:      /sw/python/2.7.1/bin/python

Dependency versions
===================
                     PyCogent version:  1.5.1
                        NumPy version:  1.5.1
                   matplotlib version:  1.1.0
                  biom-format version:  0.9.3
                QIIME library version:  1.5.0
                 QIIME script version:  1.5.0
        PyNAST version (if installed):  1.1
RDP Classifier version (if installed):  rdp_classifier-2.3.jar

QIIME config values
===================
                     blastmat_dir:      /sw/bioinformatics/ncbi/2009.3/ncbi/data
                         sc_queue:      all.q
      topiaryexplorer_project_dir:      None
     pynast_template_alignment_fp:      /sw/qiime/greengenes/core_set_aligned.fasta.imputed
                  cluster_jobs_fp:      /sw/qiime/Qiime/1.5.0/bin/start_parallel_jobs.py
pynast_template_alignment_blastdb:      None
assign_taxonomy_reference_seqs_fp:      None
                     torque_queue:      workq
              qiime_test_data_dir:      None
   template_alignment_lanemask_fp:      /sw/qiime/greengenes/lanemask_in_1s_and_0s
                    jobs_to_start:      1
                cloud_environment:      False
                qiime_scripts_dir:      /sw/qiime/Qiime/1.5.0/bin
            denoiser_min_per_core:      50
                      working_dir:      None
                    python_exe_fp:      python
                         temp_dir:      /tmp
                      blastall_fp:      blastall
                 seconds_to_sleep:      60
assign_taxonomy_id_to_taxonomy_fp:      None


running checks:

test_FastTree_supported_version (__main__.Qiime_config)
FastTree is in path and version is supported ... ok
test_INFERNAL_supported_version (__main__.Qiime_config)
INFERNAL is in path and version is supported ... ok
test_ParsInsert_supported_version (__main__.Qiime_config)
ParsInsert is in path and version is supported ... ok
test_R_supported_version (__main__.Qiime_config)
R is in path and version is supported ... ok
test_ampliconnoise_install (__main__.Qiime_config)
AmpliconNoise install looks sane. ... ok
test_blast_supported_version (__main__.Qiime_config)
blast is in path and version is supported ... ok
test_blastall_fp (__main__.Qiime_config)
blastall_fp is set to a valid path ... ok
test_blastmat_dir (__main__.Qiime_config)
blastmat_dir is set to a valid path. ... ok
test_cdbtools_supported_version (__main__.Qiime_config)
cdbtools is in path and version is supported ... ok
test_cdhit_supported_version (__main__.Qiime_config)
cd-hit is in path and version is supported ... ok
test_chimeraSlayer_install (__main__.Qiime_config)
no obvious problems with ChimeraSlayer install ... ok
test_clearcut_supported_version (__main__.Qiime_config)
clearcut is in path and version is supported ... ok
test_cluster_jobs_fp (__main__.Qiime_config)
cluster_jobs_fp is set to a valid path and is executable ... ok
test_denoiser_supported_version (__main__.Qiime_config)
denoiser aligner is ready to use ... ok
test_for_obsolete_values (__main__.Qiime_config)
local qiime_config has no extra params ... ok
test_matplotlib_suported_version (__main__.Qiime_config)
maptplotlib version is supported ... ok
test_mothur_supported_version (__main__.Qiime_config)
mothur is in path and version is supported ... ok
test_muscle_supported_version (__main__.Qiime_config)
muscle is in path and version is supported ... ok
test_numpy_suported_version (__main__.Qiime_config)
numpy version is supported ... ok
test_pplacer_supported_version (__main__.Qiime_config)
pplacer is in path and version is supported ... ok
test_pynast_suported_version (__main__.Qiime_config)
pynast version is supported ... ok
test_pynast_template_alignment_blastdb_fp (__main__.Qiime_config)
pynast_template_alignment_blastdb, if set, is set to a valid path ... ok
test_pynast_template_alignment_fp (__main__.Qiime_config)
pynast_template_alignment, if set, is set to a valid path ... ok
test_python_exe_fp (__main__.Qiime_config)
python_exe_fp is set to a working python env ... ok
test_python_supported_version (__main__.Qiime_config)
python is in path and version is supported ... ok
test_qiime_scripts_dir (__main__.Qiime_config)
qiime_scripts_dir, if set, is set to a valid path ... ok
test_qiime_test_data_dir (__main__.Qiime_config)
qiime_test_data_dir, if set, is set to a valid path ... ok
test_raxmlHPC_supported_version (__main__.Qiime_config)
raxmlHPC is in path and version is supported ... ok
test_rtax_supported_version (__main__.Qiime_config)
rtax is in path and version is supported ... ok
test_temp_dir (__main__.Qiime_config)
temp_dir, if set, is set to a valid path ... ok
test_template_alignment_lanemask_fp (__main__.Qiime_config)
template_alignment_lanemask, if set, is set to a valid path ... ok
test_uclust_supported_version (__main__.Qiime_config)
uclust is in path and version is supported ... ok
test_usearch_supported_version (__main__.Qiime_config)
usearch is in path and version is supported ... ok
test_working_dir (__main__.Qiime_config)
working_dir, if set, is set to a valid path ... ok

----------------------------------------------------------------------
Ran 34 tests in 0.318s

OK

module load python/2.7.1
module load qiime/1.3.0
module load bioinformatics/uclust/1.2.22
module load bioinformatics/fasttree/2.1.3
module load bioinformatics/rdpclassifier/2.3
module load R/2.13.0
module load blast/2.2.25
module load bioinformatics/cd-hit/4.5.4
module load bioinformatics/cdbfasta/0.99
module load bioinformatics/chimeraslayer/r20110519
module load bioinformatics/mothur/1.21.1
module load bioinformatics/clearcut/1.0.9
module load bioinformatics/raxml/7.2.8a-mpi #(other versions available)
module load bioinformatics/infernal/1.0.2-mpi #(OR  module load bioinformatics/infernal/1.0.2-serial)
module load bioinformatics/mafft/6.857 # (OR: module load bioinformatics/mafft/6.857-extensions)
module load bioinformatics/muscle/3.8.31
module load gsl/gsl-1.15
module load bioinformatics/greengenes/gg
module load bioinformatics/ampliconnoise/1.25
module load bioinformatics/ghc/7.0.3
module load cytoscape/2.8.1
module load mpi/openMPI/1.4.3-gnu #(optional)

mount --bind /proc/ /compute/proc/
mount --bind /dev /compute/dev
yum --installroot=/compute/ groupinstall "Development Tools"
umount /compute/dev
umount /compute/proc

module load python/2.7.1

module load python/2.7.1

module load python/2.7.1

 module load bioinformatics/uclust/1.2.22 

mkdir -p /sw/qiime/uclust/1.2.22
cp /data1/qiime/uclustq1.2.22_i86linux64 /sw/qiime/uclust/1.2.22
cd /sw/qiime/uclust/1.2.22
chmod a+x uclustq1.2.22_i86linux64
mv  uclustq1.2.22_i86linux64 uclust
cp uclust uclustq1.2.22_i86linux64

/sw/qiime/uclust/1.2.22

module load python/2.7.1

mkdir -p /sw/qiime/PyNAST
cd /sw/qiime/PyNAST
cp -i /data1/qiime/PyNAST-1.1.tgz .
tar -zxvf PyNAST-1.1.tgz
mv PyNAST-1.1 1.1
cd /sw/qiime/PyNAST/1.1
python setup.py install
cd tests
python all_tests.py
cd
pynast -h

python setup.py install
running install
running build
running build_py
creating build
creating build/lib
creating build/lib/pynast
copying pynast/__init__.py -> build/lib/pynast
copying pynast/logger.py -> build/lib/pynast
copying pynast/util.py -> build/lib/pynast
running build_scripts
creating build/scripts-2.7
copying and adjusting scripts/pynast -> build/scripts-2.7
changing mode of build/scripts-2.7/pynast from 644 to 755
running install_lib
creating /sw/python/2.7.1/lib/python2.7/site-packages/pynast
copying build/lib/pynast/__init__.py -> /sw/python/2.7.1/lib/python2.7/site-packages/pynast
copying build/lib/pynast/logger.py -> /sw/python/2.7.1/lib/python2.7/site-packages/pynast
copying build/lib/pynast/util.py -> /sw/python/2.7.1/lib/python2.7/site-packages/pynast
byte-compiling /sw/python/2.7.1/lib/python2.7/site-packages/pynast/__init__.py to __init__.pyc
byte-compiling /sw/python/2.7.1/lib/python2.7/site-packages/pynast/logger.py to logger.pyc
byte-compiling /sw/python/2.7.1/lib/python2.7/site-packages/pynast/util.py to util.pyc
running install_scripts
copying build/scripts-2.7/pynast -> /sw/python/2.7.1/bin
changing mode of /sw/python/2.7.1/bin/pynast to 755
running install_egg_info
Writing /sw/python/2.7.1/lib/python2.7/site-packages/PyNAST-1.1-py2.7.egg-info

module load bioinformatics/greengenes/gg 

module load bioinformatics/fasttree/2.1.3

mkdir -p /sw/qiime/fasttree/2.1.3
wget http://www.microbesonline.org/fasttree/FastTree-2.1.3.c

gcc -lm -O3 -finline-functions -funroll-loops -Wall -o FastTree FastTree-2.1.3.c

multi-threaded "FastTreeMP," use

gcc -DOPENMP -fopenmp -lm -O3 -finline-functions -funroll-loops -Wall -o FastTreeMP FastTree-2.1.3.c

 ls -la /usr/bin/java
lrwxrwxrwx. 1 root root 22 May 26 05:30 /usr/bin/java -> /etc/alternatives/java
ls -la  /etc/alternatives/java
lrwxrwxrwx. 1 root root 35 May 26 05:30 /etc/alternatives/java -> /usr/lib/jvm/jre-1.6.0-sun/bin/java

module load bioinformatics/rdpclassifier/2.3

General RDP Contact
Ribosomal Database Project
2225A Biomedical and Physical Sciences Building
Michigan State University
East Lansing, MI, 48824 
rdpstaff@msu.edu

set base_path           /sw/qiime/
set rdp_base            $base_path/rdp_classifier/2.3
setenv          RDP_JAR_PATH    $rdp_base/rdp_classifier-2.3.jar

OR:

setenv RDP_JAR_PATH  /sw/qiime/rdp_classifier/2.3/rdp_classifier-2.3.jar

module load blast/2.2.25

module display blast/2.2.25
-------------------------------------------------------------------
/sw/com/modulefiles/blast/2.2.25:

prepend-path     PATH /sw/blast/2.2.25/ncbi/bin
prepend-path     MANPATH /sw/blast/2.2.25/ncbi/doc/man
setenv           NCBI /sw/blast/2.2.25/local
-------------------------------------------------------------------

cd /sw/qiime
tar -zxvf /data1/cd-hit-v4.5.4-2011-03-07.tgz
mkdir /sw/qiime/cd-hit
cd /sw/qiime/cd-hit
mv ../cd-hit-v4.5.4-2011-03-07 4.5.4
cd /sw/qiime/cd-hit/4.5.4
You can take advantage of multiple-­?threaded function of cd-­?hit to speed up calculation

make openmp=yes 2>&1 |tee cd-hit-install.txt

 module load bioinformatics/cd-hit/4.5.4

cd /sw/qiime
tar -zxvf /data1/cdbfasta.tar.gz
mv cdbfasta 0.99
mkdir /sw/qiime/cdbfasta
mv 0.99 /sw/qiime/cdbfasta
cd  /sw/qiime/cdbfasta/0.99

export GCLDIR=/sw/qiime/cdbfasta/gclib
 make 2>&1 |tee cdbfasta.txt

module load bioinformatics/cdbfasta/0.99 

 module load bioinformatics/chimeraslayer/r20110519

module load blast/2.2.25

module load bioinformatics/cdbfasta/0.99 

module load blast/2.2.25
module load bioinformatics/cdbfasta/0.99 

cd /sw/qiime
tar -zxvf /data1/microbiomeutil-r20110519.tgz
mkdir microbiomeutil
mv microbiomeutil-r20110519 microbiomeutil/r20110519
cd /sw/qiime/microbiomeutil/r20110519
 make 2>&1 |tee microbiomeutil_install.txt 


Run tests in the following order:

        make testNast 2>&1 |tee make_testNast.txt

        make testChimeraSlayer 2>&1 |tee make_testChimeraSlayer.txt

        make testWigeon 2>&1 |tee make_testWigeon.txt

 

module load bioinformatics/mothur/1.21.1

cd /sw/qiime
unzip /data1/Mothur.1.21.1.zip
mkdir mothur
mv Mothur.source mothur/1.21.1
cd /sw/qiime/mothur/1.21.1

module load mpi/openMPI/1.4.3-gnu

vi makefile

make the following changes:

Change from:
============

CC_OPTIONS = -O3
CXXFLAGS +=  -O3   #in 1.13 or 1.12 CC_OPTIONS = CXXFLAGS

To:
===
CC_OPTIONS = -O3 -mtune=native -march=native -m64
CXXFLAGS  += -O3 -m64  #in 1.13 or 1.12 CC_OPTIONS = CXXFLAGS

64BIT_VERSION ?= yes
USEMPI ?= yes

MOTHUR_FILES="\"/sw/qiime/mothur/1.21.1\""


 #if you are a linux user use the following line
        CXXFLAGS += -mtune=native -march=native -m64

#if you are a mac user use the following line
        #TARGET_ARCH += -arch x86_64  <===Comment this out

yum install readline-devel ncurses-devel  ==> install on nodes as well as it is important for mothur install
( mount --bind /proc/ /compute/proc/; mount --bind /dev /compute/dev;yum --installroot=/compute/ yum install readline-devel ncurses-devel;umount /compute/dev;umount /compute/proc)

module load mpi/openMPI/1.4.3-gnu
make 2>&1 |tee make_mothur_install.txt

mkdir /sw/qiime/mothur/1.25.0/src
cd  /sw/qiime/mothur/1.25.0/src
wget http://www.mothur.org/w/images/6/6d/Mothur.1.25.0.zip
cd /sw/qiime/mothur/1.25.0/src/Mothur.source
module load mpi/openMPI/1.4.3-gnu
vi makefile
edit makefile and comment out line 31: #TARGET_ARCH += -arch x86_64 
make 2>&1 |tee makeLog.txt
mkdir /sw/qiime/mothur/1.25.0/bin
cp mothur /sw/qiime/mothur/1.25.0/bin
(or ln -s /sw/qiime/mothur/1.25.0/mothur /sw/qiime/mothur/1.25.0/bin/mothus)

module load bioinformatics/clearcut/1.0.9

cd  /sw/qiime
unzip /data1/Clearcut.source.zip
mv clearcut 1.0.9
mkdir -p /sw/qiime/clearcut
mv 1.0.9 clearcut/
cd /sw/qiime/clearcut/1.0.9

vi Makefile

# Specify your compiler here
CC      = mpicc
# DEFAULT GCC OPTIMIZATION CONFIGURATION (ALL ARCHITECTURES)
#CFLAGS = -O3 -Wall -funroll-loops -fomit-frame-pointer
CFLAGS = -O3 -Wall -funroll-loops -fomit-frame-pointer -mtune=native -march=native -m64

make  2>&1 |tee make_clearcut_install.txt
mkdir bin
cd /sw/qiime/clearcut/1.0.9/bin

 module load bioinformatics/raxml/7.2.8a-mpi

mkdir -p /sw/bioinformatics/raxml
mkdir /sw/bioinformatics/raxml/7.2.8a/mpi/ompi

cd /sw/bioinformatics/raxml/7.2.8a/mpi/ompi
bunzip2 /data1/RAxML-7.2.8-ALPHA.tar.bz2
tar -xvf /data1/RAxML-7.2.8-ALPHA.tar

MPI version
===========

cd /sw/bioinformatics/raxml/7.2.8a/mpi/ompi
make -f Makefile.MPI.gcc 2>&1 |tee make_RAxML_install.txt

openMP version
==============
mkdir /sw/bioinformatics/raxml/7.2.8a/omp
cd /sw/bioinformatics/raxml/7.2.8a/omp
tar -xvf /data1/RAxML-7.2.8-ALPHA.tar
mv RAxML-7.2.8-ALPHA/* .
rmdir RAxML-7.2.8-ALPHA
make -f Makefile.PTHREADS.gcc  2>&1 |tee make_RAxML_openMI_install.txt
mkdir bin;cp -rp raxmlHPC-PTHREADS bin/

Serial
======

mkdir /sw/bioinformatics/raxml/7.2.8a/serial
cd /sw/bioinformatics/raxml/7.2.8a/serial
mv RAxML-7.2.8-ALPHA/* .
rmdir RAxML-7.2.8-ALPHA
make -f Makefile.gcc  2>&1 |tee make_RAxML_serial_install.txt
 mkdir bin;cp -rp  raxmlHPC bin/

raxmlHPC
=====

mkdir /sw/bioinformatics/raxml/7.3.0/src
cd /sw/bioinformatics/raxml/7.3.0/src
wget ftp://thebeast.colorado.edu/pub/QIIME-v1.5.0-dependencies/stamatak-standard-RAxML-5_7_2012.tgz
tar -zxvf stamatak-standard-RAxML-5_7_2012.tgz
cd /sw/bioinformatics/raxml/7.3.0/src/stamatak-standard-RAxML-5_7_2012
make -f Makefile.SSE3.gcc
mkdir /sw/bioinformatics/raxml/7.3.0/bin
cp raxmlHPC-SSE3 /sw/bioinformatics/raxml/7.3.0/bin/raxmlHPC
#OR: ln -s /sw/bioinformatics/raxml/7.3.0/raxmlHPC-SSE3 /sw/bioinformatics/raxml/7.3.0/bin/raxmlHPC

module load bioinformatics/infernal/1.0.2-mpi

 module load bioinformatics/infernal/1.0.2-serial

Installation instruction from the user guide
=============================================
Download the source tarball (infernal.tar.gz) from ftp://selab.janelia.org/pub/software/infernal/ or
http://infernal.janelia.org.
Unpack the software:
> tar xvf infernal.tar.gz
Go into the newly created top-level directory (named either infernal, or infernal-xx where xx is
a release number):
> cd infernal
Configure for your system, and build the programs:
> ./configure --prefix=/usr/mylocal --enable-mpi
> make
Run the automated testsuite. This is optional. All these tests should pass:
> make check
The programs are now in the src/ subdirectory. The user’s guide (this document) is in the
documentation/userguide subdirectory. The man pages are in the documentation/manpages subdirectory.
You can manually move or copy all of these to appropriate locations if you want. You will want
the programs to be in your $PATH.
make install

To run a program in MPI mode, you must run them in an MPI environment with mpirun or mpiexec,
with the --mpi option enabled. For example, in our LAM environment:
> mpirun C cmsearch --mpi query.cm target.fa
Other environments besides LAM MPI should work also, but may require different command syntax.

mkdir -p /sw/bioinformatics/infernal/1.0.2
cd /sw/bioinformatics/infernal/1.0.2/
tar -zxvf /data1/infernal.tar.gz
mkdir ompi
mkdir serial
cp -rp infernal-1.0.2 ompi/
cp -rp infernal-1.0.2 serial/

Using openMPI 
=============

cd /sw/bioinformatics/infernal/1.0.2/ompi/infernal-1.0.2
module load  mpi/openMPI/1.4.3-gnu 
./configure --prefix=/sw/bioinformatics/infernal/1.0.2/ompi --enable-mpi 2>&1 |tee configure_infernal-1.0.2.txt
make 2>&1 |tee make_infernal-1.0.2.txt
make check
All 59 exercises at level <= 4 passed.
make install

Serial build 
=============

cd /sw/bioinformatics/infernal/1.0.2/serial/infernal-1.0.2
./configure --prefix=/sw/bioinformatics/infernal/1.0.2/serial 2>&1 |tee configure_serial_infernal-1.0.2.txt
make  2>&1 |tee make_serial_infernal-1.0.2.txt
make check
make install

 module load bioinformatics/muscle/3.8.31
 

mkdir /sw/bioinformatics/muscle/3.8.31
cp /data1/muscle3.8.31_i86linux64 .
mv muscle3.8.31_i86linux64 muscle
chmod +x muscle

module load gsl/gsl-1.15

module load bioinformatics/mafft/6.857

 module load bioinformatics/mafft/6.857-extensions 

mkdir /sw/bioinformatics/mafft
tar -zxvf  /data1/mafft-6.857-with-extensions-src.tgz
mv mafft-6.857-with-extensions 6.857
cd /sw/bioinformatics/mafft/src/core
To enable multithreading, uncomment line 8 of Makefile.
vi Makefile (any other text editor is ok.)
ENABLE_MULTITHREAD = -Denablemultithread
#Uncomment this to enable multithreading (linux only)


>>
PREFIX = /sw/bioinformatics/mafft/6.857
LIBDIR = $(PREFIX)/libexec/mafft
BINDIR = $(PREFIX)/bin
MANDIR = $(PREFIX)/share/man/man1

#MNO_CYGWIN = -mno-cygwin

ENABLE_MULTITHREAD = -Denablemultithread

>>>>>>
make clean
make 2>&1 |tee make_muffat.txt
make install 2>&1 |tee make_install_muffat.txt

MAFFT Extensions
=================
cd /sw/bioinformatics/mafft/src/extensions
vi Makefile
>>>>>
PREFIX = /sw/bioinformatics/mafft/6.857

>>>>>

make clean
make 2>&1 |tee make_mafft_ext.txt
make install 2>&1 |tee make_install_muffat_ext.txt

 module load bioinformatics/ampliconnoise/1.25

cd /sw/bioinformatics
tar -zxvf /data1/AmpliconNoiseV1.25.tar.gz
mkdir AmpliconNoise/1.25
mv AmpliconNoiseV1.25 AmpliconNoise/1.25/
cd /sw/bioinformatics/AmpliconNoise/1.25/AmpliconNoiseV1.25
module load gsl/gsl-1.15;module load bioinformatics/mafft/6.857
make clean
make 2>&1 |tee make_ampliconNoise.txt
make install

 module load bioinformatics/ghc/7.0.3

mkdir /sw/bioinformatics/ghc
cd /sw/bioinformatics/ghc
bunzip2  /data1/ghc-7.0.3-x86_64-unknown-linux.tar.bz2
tar -xvf /data1/ghc-7.0.3-x86_64-unknown-linux.tar
mkdir /sw/bioinformatics/ghc/7.0.3
cd /sw/bioinformatics/ghc/ghc-7.0.3
./configure --prefix=/sw/bioinformatics/ghc/7.0.3 2>&1 |tee configure_ghc703.txt

(Examine the generated config.status and Makefile files to check if all is well...)
make show-install-setup 

make install 2>&1 |tee make_ghc703.txt

module load python/2.7.1

module load cytoscape/2.8.1

module load R/2.13.0

module load R/2.13.0

install.packages('randomForest')
q()

* installing *source* package ârandomForestâ ...
** libs
gcc -std=gnu99 -I/sw/R/2.13.0/lib64/R/include  -I/usr/local/include    -fpic  -g -O2 -c classTree.c -o classTree.o
gcc -std=gnu99 -I/sw/R/2.13.0/lib64/R/include  -I/usr/local/include    -fpic  -g -O2 -c regTree.c -o regTree.o
gcc -std=gnu99 -I/sw/R/2.13.0/lib64/R/include  -I/usr/local/include    -fpic  -g -O2 -c regrf.c -o regrf.o
gcc -std=gnu99 -I/sw/R/2.13.0/lib64/R/include  -I/usr/local/include    -fpic  -g -O2 -c rf.c -o rf.o
gfortran   -fpic  -g -O2 -c rfsub.f -o rfsub.o
gcc -std=gnu99 -I/sw/R/2.13.0/lib64/R/include  -I/usr/local/include    -fpic  -g -O2 -c rfutils.c -o rfutils.o
gcc -std=gnu99 -shared -L/usr/local/lib64 -o randomForest.so classTree.o regTree.o regrf.o rf.o rfsub.o rfutils.o -lgfortran -lm -L/sw/R/2.13.0/lib64/R/lib -lR
installing to /sw/R/2.13.0/lib64/R/library/randomForest/libs
** R
** data
** inst
** preparing package for lazy loading
** help
*** installing help indices
** building package indices ...
** testing if installed package can be loaded

* DONE (randomForest)

The downloaded packages are in
        â/tmp/RtmprZm6wd/downloaded_packagesâ
Updating HTML index of packages in '.Library'
Making packages.html  ... done
> q()
Save workspace image? [y/n/c]: n

module load bioinformatics/greengenes/gg 

cd /sw/qiime/greengenes
cp  /data1/gg_otus_6oct2010.zip  .
unzip gg_otus_6oct2010.zip
cd /sw/qiime/greengenes/gg_otus_6oct2010/

module load python/2.7.1

wget http://pypi.python.org/packages/2.7/S/Sphinx/Sphinx-1.0.7-py2.7.egg#md5=1321a3888d4fad656a5ede5838686e12
module load python/2.7.1
easy_install Sphinx-1.0.7-py2.7.egg

[root@admin data1]# easy_install Sphinx-1.0.7-py2.7.egg
Processing Sphinx-1.0.7-py2.7.egg
creating /sw/python/2.7.1/lib/python2.7/site-packages/Sphinx-1.0.7-py2.7.egg
Extracting Sphinx-1.0.7-py2.7.egg to /sw/python/2.7.1/lib/python2.7/site-packages
Adding Sphinx 1.0.7 to easy-install.pth file
Installing sphinx-build script to /sw/python/2.7.1/bin
Installing sphinx-quickstart script to /sw/python/2.7.1/bin
Installing sphinx-autogen script to /sw/python/2.7.1/bin

Installed /sw/python/2.7.1/lib/python2.7/site-packages/Sphinx-1.0.7-py2.7.egg
Processing dependencies for Sphinx==1.0.7
Searching for docutils>=0.5
Reading http://pypi.python.org/simple/docutils/
Reading http://docutils.sourceforge.net/
Best match: docutils 0.8
Downloading http://pypi.python.org/packages/source/d/docutils/docutils-0.8.tar.gz#md5=f57474b69bfbf0eb608706a104f92dda
Processing docutils-0.8.tar.gz
Running docutils-0.8/setup.py -q bdist_egg --dist-dir /tmp/easy_install-oAgwED/docutils-0.8/egg-dist-tmp-F6zwlI
warning: no files found matching 'MANIFEST'
warning: no previously-included files matching '.cvsignore' found under directory '*'
warning: no previously-included files matching '*.pyc' found under directory '*'
warning: no previously-included files matching '*~' found under directory '*'
warning: no previously-included files matching '.DS_Store' found under directory '*'
zip_safe flag not set; analyzing archive contents...
docutils.writers.s5_html.__init__: module references __file__
docutils.writers.html4css1.__init__: module references __file__
docutils.writers.latex2e.__init__: module references __file__
docutils.writers.pep_html.__init__: module references __file__
docutils.writers.odf_odt.__init__: module references __file__
docutils.parsers.rst.directives.misc: module references __file__
Adding docutils 0.8 to easy-install.pth file
Installing rst2xml.py script to /sw/python/2.7.1/bin
Installing rst2odt_prepstyles.py script to /sw/python/2.7.1/bin
Installing rstpep2html.py script to /sw/python/2.7.1/bin
Installing rst2xetex.py script to /sw/python/2.7.1/bin
Installing rst2pseudoxml.py script to /sw/python/2.7.1/bin
Installing rst2man.py script to /sw/python/2.7.1/bin
Installing rst2html.py script to /sw/python/2.7.1/bin
Installing rst2odt.py script to /sw/python/2.7.1/bin
Installing rst2s5.py script to /sw/python/2.7.1/bin
Installing rst2latex.py script to /sw/python/2.7.1/bin

Installed /sw/python/2.7.1/lib/python2.7/site-packages/docutils-0.8-py2.7.egg
Searching for Jinja2>=2.2
Reading http://pypi.python.org/simple/Jinja2/
Reading http://jinja.pocoo.org/
Best match: Jinja2 2.6
Downloading http://pypi.python.org/packages/source/J/Jinja2/Jinja2-2.6.tar.gz#md5=1c49a8825c993bfdcf55bb36897d28a2
Processing Jinja2-2.6.tar.gz
Running Jinja2-2.6/setup.py -q bdist_egg --dist-dir /tmp/easy_install-evp4VJ/Jinja2-2.6/egg-dist-tmp-YT9MZB
warning: no previously-included files matching '*' found under directory 'docs/_build'
warning: no previously-included files matching '*.pyc' found under directory 'jinja2'
warning: no previously-included files matching '*.pyc' found under directory 'docs'
warning: no previously-included files matching '*.pyo' found under directory 'jinja2'
warning: no previously-included files matching '*.pyo' found under directory 'docs'
Adding Jinja2 2.6 to easy-install.pth file

Installed /sw/python/2.7.1/lib/python2.7/site-packages/Jinja2-2.6-py2.7.egg
Searching for Pygments>=0.8
Reading http://pypi.python.org/simple/Pygments/
Reading http://pygments.org/
Reading http://pygments.pocoo.org/
Best match: Pygments 1.4
Downloading http://pypi.python.org/packages/2.7/P/Pygments/Pygments-1.4-py2.7.egg#md5=acbdde4dae30efaba8cfa86dcb6070f2
Processing Pygments-1.4-py2.7.egg
creating /sw/python/2.7.1/lib/python2.7/site-packages/Pygments-1.4-py2.7.egg
Extracting Pygments-1.4-py2.7.egg to /sw/python/2.7.1/lib/python2.7/site-packages
Adding Pygments 1.4 to easy-install.pth file
Installing pygmentize script to /sw/python/2.7.1/bin

Installed /sw/python/2.7.1/lib/python2.7/site-packages/Pygments-1.4-py2.7.egg
Finished processing dependencies for Sphinx==1.0.7

module load qiime/1.3.0

mkdir /sw/qiime/Qiime
cd /sw/qiime/Qiime
tar -zxvf /data1/Qiime-1.3.0.tar.gz
mv Qiime-1.3.0 1.3.0
cd /sw/qiime/Qiime/1.3.0
By default the QIIME scripts will be installed in /usr/local/bin. As there are a lot of QIIME scripts, we highly recommend customizing the script directory to keep your system organized. This can be customized with the --install_scripts option. You also can specify and alternate directory for the library files with --install-purelib, but if you do so you must also specify --install-data as the same directory. Failure to do this will result in a broken QIIME install. An example command is:


python setup.py install --install-scripts=/sw/qiime/Qiime/1.3.0/bin 2>&1 |tee qiime_installLOG.txt
OR:

python setup.py install --install-scripts=/home/qiime/bin/ --install-purelib=/home/qiime/lib/ --install-data=/home/qiime/lib/ 2>&1 |tee qiime_installLOG.txt


python setup.py install --install-scripts=/sw/qiime/Qiime/1.3.0/bin 2>&1 |tee qiime_installLOG.txt


copying static files... done
dumping search index... done
dumping object inventory... done
build succeeded, 36 warnings.

Build finished. The HTML pages are in _build/html.
Local documentation built with Sphinx. Open to following path with a web browser:
/sw/qiime/Qiime/1.3.0/doc/_build/html/index.html

####cp /sw/qiime/Qiime/1.3.0/qiime/support_files/qiime_config /sw/qiime/Qiime/1.3.0/.qiime_config

cp  /sw/qiime/Qiime/1.3.0/.qiime_config ~/

Edit .qiime_config
and add:

Find the line beginning qiime_scripts_dir and add a tab, followed by the QIIME scripts directory (/sw/qiime/Qiime/1.3.0/bin)

cd /sw/qiime/Qiime/1.3.0/bin

python print_qiime_config.py -t
python print_qiime_config.py -t >/tmp/qq 2>&1


test_FastTree_supported_version (__main__.Qiime_config)
FastTree is in path and version is supported ... ok
test_INFERNAL_supported_version (__main__.Qiime_config)
INFERNAL is in path and version is supported ... ok
test_ampliconnoise_install (__main__.Qiime_config)
AmpliconNoise install looks sane. ... ok
test_blast_supported_version (__main__.Qiime_config)
blast is in path and version is supported ... FAIL
test_blastall_fp (__main__.Qiime_config)
blastall_fp is set to a valid path ... ok
test_blastmat_dir (__main__.Qiime_config)
blastmat_dir is set to a valid path. ... ok
test_cdbtools_supported_version (__main__.Qiime_config)
cdbtools is in path and version is supported ... ok
test_cdhit_supported_version (__main__.Qiime_config)
cd-hit is in path and version is supported ... ok
test_chimeraSlayer_install (__main__.Qiime_config)
no obvious problems with ChimeraSlayer install ... ok
test_clearcut_supported_version (__main__.Qiime_config)
clearcut is in path and version is supported ... ok
test_cluster_jobs_fp (__main__.Qiime_config)
cluster_jobs_fp is set to a valid path and is executable ... ok
test_denoiser_supported_version (__main__.Qiime_config)
denoiser aligner is ready to use ... FAIL
test_for_obsolete_values (__main__.Qiime_config)
local qiime_config has no extra params ... ok
test_matplotlib_suported_version (__main__.Qiime_config)
maptplotlib version is supported ... FAIL
test_mothur_supported_version (__main__.Qiime_config)
mothur is in path and version is supported ... ERROR
test_muscle_supported_version (__main__.Qiime_config)
muscle is in path and version is supported ... FAIL
test_numpy_suported_version (__main__.Qiime_config)
numpy version is supported ... FAIL
test_pynast_suported_version (__main__.Qiime_config)
pynast version is supported ... ok
test_pynast_template_alignment_blastdb_fp (__main__.Qiime_config)
pynast_template_alignment_blastdb, if set, is set to a valid path ... ok
test_pynast_template_alignment_fp (__main__.Qiime_config)
pynast_template_alignment, if set, is set to a valid path ... ok
test_python_exe_fp (__main__.Qiime_config)
python_exe_fp is set to a working python env ... ok
test_python_supported_version (__main__.Qiime_config)
python is in path and version is supported ... FAIL
test_qiime_scripts_dir (__main__.Qiime_config)
qiime_scripts_dir, if set, is set to a valid path ... ok
test_raxmlHPC_supported_version (__main__.Qiime_config)
raxmlHPC is in path and version is supported ... FAIL
test_temp_dir (__main__.Qiime_config)
temp_dir, if set, is set to a valid path ... ok
test_template_alignment_lanemask_fp (__main__.Qiime_config)
template_alignment_lanemask, if set, is set to a valid path ... ok
test_uclust_supported_version (__main__.Qiime_config)
uclust is in path and version is supported ... ok
test_working_dir (__main__.Qiime_config)
working_dir, if set, is set to a valid path ... ok

======================================================================
ERROR: test_mothur_supported_version (__main__.Qiime_config)
mothur is in path and version is supported
----------------------------------------------------------------------
Traceback (most recent call last):
  File "print_qiime_config.py", line 472, in test_mothur_supported_version
    version_string = stdout.strip().split(' ')[1].strip('v.')
IndexError: list index out of range

======================================================================
FAIL: test_blast_supported_version (__main__.Qiime_config)
blast is in path and version is supported
----------------------------------------------------------------------
----------------------------------------------------------------------
Traceback (most recent call last):
  File "print_qiime_config.py", line 374, in test_blast_supported_version
    % ('.'.join(map(str,acceptable_version)), version_string))
AssertionError: Unsupported blast version. 2.2.22 is required, but running 2.2.25.

======================================================================
FAIL: test_denoiser_supported_version (__main__.Qiime_config)
denoiser aligner is ready to use
----------------------------------------------------------------------
Traceback (most recent call last):
  File "print_qiime_config.py", line 497, in test_denoiser_supported_version
    "which components of QIIME you plan to use.")
AssertionError: Denoiser flowgram aligner not found or not executable.This may or may not be a problem depending on which components of QIIME you plan to use.

======================================================================
FAIL: test_matplotlib_suported_version (__main__.Qiime_config)
maptplotlib version is supported
----------------------------------------------------------------------
Traceback (most recent call last):
  File "print_qiime_config.py", line 332, in test_matplotlib_suported_version
    version_string))
AssertionError: Unsupported matplotlib version. Must be >= 0.98.5.3 and < 0.98.5.4 , but running 1.0.1.

======================================================================
FAIL: test_muscle_supported_version (__main__.Qiime_config)
muscle is in path and version is supported
----------------------------------------------------------------------
Traceback (most recent call last):
  File "print_qiime_config.py", line 458, in test_muscle_supported_version
    % ('.'.join(map(str,acceptable_version)), version_string))
AssertionError: Unsupported muscle version. 3.6 is required, but running 3.8.31.

======================================================================
FAIL: test_numpy_suported_version (__main__.Qiime_config)
numpy version is supported
----------------------------------------------------------------------
Traceback (most recent call last):
  File "print_qiime_config.py", line 314, in test_numpy_suported_version
    version_string))
AssertionError: Unsupported numpy version. Must be >= 1.3.0 and < 1.5.1 , but running 1.5.1.

======================================================================
FAIL: test_python_supported_version (__main__.Qiime_config)
python is in path and version is supported
----------------------------------------------------------------------
Traceback (most recent call last):
  File "print_qiime_config.py", line 296, in test_python_supported_version
    version_string))
AssertionError: Unsupported python version. Must be >= 2.6.0 and < 2.7.0 , but running 2.7.1.

======================================================================
FAIL: test_raxmlHPC_supported_version (__main__.Qiime_config)
raxmlHPC is in path and version is supported
----------------------------------------------------------------------
Traceback (most recent call last):
  File "print_qiime_config.py", line 504, in test_raxmlHPC_supported_version
    "which components of QIIME you plan to use.")
AssertionError: raxmlHPC not found. This may or may not be a problem depending on which components of QIIME you plan to use.

----------------------------------------------------------------------
Ran 28 tests in 0.240s

FAILED (failures=7, errors=1)

System information
==================
         Platform:      linux2
   Python version:      2.7.1 (r271:86832, Jun 29 2011, 09:08:45)  [GCC 4.4.5 20110214 (Red Hat 4.4.5-6)]
Python executable:      /sw/python/2.7.1/bin/python

Dependency versions
===================
                     PyCogent version:  1.5.1
                        NumPy version:  1.5.1
                   matplotlib version:  1.0.1
                QIIME library version:  1.3.0
                 QIIME script version:  1.3.0
        PyNAST version (if installed):  1.1
RDP Classifier version (if installed):  rdp_classifier-2.3.jar

QIIME config values
===================
                     blastmat_dir:      None
      topiaryexplorer_project_dir:      None
     pynast_template_alignment_fp:      /sw/qiime/greengenes/core_set_aligned.fasta.imputed
                  cluster_jobs_fp:      /sw/qiime/Qiime/1.3.0/bin/start_parallel_jobs.py
pynast_template_alignment_blastdb:      None
                     torque_queue:      friendlyq
   template_alignment_lanemask_fp:      /sw/qiime/greengenes/lanemask_in_1s_and_0s
                    jobs_to_start:      1
                cloud_environment:      False
                qiime_scripts_dir:      /sw/qiime/Qiime/1.3.0/bin
            denoiser_min_per_core:      50
                      working_dir:      None
                    python_exe_fp:      python
                         temp_dir:      None
                      blastall_fp:      blastall
                 seconds_to_sleep:      60

align_seqs.py -h
 align_seqs.py -h
Usage: align_seqs.py [options] {-i/--input_fasta_fp INPUT_FASTA_FP}

[] indicates optional input (order unimportant)
{} indicates required input (order unimportant)


This script aligns the sequences in a FASTA file to each other or to a template sequence alignment, depending on the method chosen. Currently, there are three methods which can be used by the user:

1. PyNAST (Caporaso et al., 2009) - The default alignment method is PyNAST, a python implementation of the NAST alignment algorithm.  The NAST algorithm aligns each provided sequence (the "candidate" sequence) to the best-matching sequence in a pre-aligned database of sequences (the "template" sequence).  Candidate sequences are not permitted to introduce new gap characters into the template database, so the algorithm introduces local mis-alignments to preserve the existing template sequence.

2. MUSCLE (Edgar, 2004) - MUSCLE is an alignment method which stands for MUltiple Sequence Comparison by Log-Expectation.

3. INFERNAL (Nawrocki, Kolbe, & Eddy, 2009) - Infernal ("INFERence of RNA ALignment") is for an alignment method for using RNA structure and sequence similarities.


Example usage:
Print help message and exit
 align_seqs.py -h

Alignment with MUSCLE: One could also use the MUSCLE algorithm. The following command can be used to align sequences (i.e. the resulting FASTA file from pick_rep_set.py), where the output is written to the directory "muscle_alignment/"
 align_seqs.py -i repr_set_seqs.fasta -m muscle -o muscle_alignment/

Alignment with PyNAST: The default alignment method is PyNAST, a python implementation of the NAST alignment algorithm. The NAST algorithm aligns each provided sequence (the "candidate" sequence) to the best-matching sequence in a pre-aligned database of sequences (the "template" sequence). Candidate sequences are not permitted to introduce new gap characters into the template database, so the algorithm introduces local mis-alignments to preserve the existing template sequence. The quality thresholds are the minimum requirements for matching between a candidate sequence and a template sequence. The set of matching template sequences will be searched for a match that meets these requirements, with preference given to the sequence length. By default, the minimum sequence length is 150 and the minimum percent id is 75%. The minimum sequence length is much too long for typical pyrosequencing reads, but was chosen for compatibility with the original NAST tool.

The following command can be used for aligning sequences using the PyNAST method, where we supply the program with a FASTA file of unaligned sequences (i.e. resulting FASTA file from pick_rep_set.py, a FASTA file of pre-aligned sequences (this is the template file, which is typically the Greengenes core set - available from http://greengenes.lbl.gov/), and the results will be written to the directory "pynast_aligned/"
 align_seqs.py -i repr_set_seqs.fasta -t core_set_template.fasta -o pynast_aligned/

Alternatively, one could change the minimum sequence length ("-e") requirement and minimum sequence identity ("-p"), using the following command
 align_seqs.py -i repr_set_seqs.fasta -t core_set_template.fasta -o pynast_aligned/ -e 500 -p 95.0

Alignment with Infernal: An alternative alignment method is to use Infernal. Infernal is similar to the PyNAST method, in that you supply a template alignment, although Infernal has several distinct differences. Infernal takes a multiple sequence alignment with a corresponding secondary structure annotation. This input file must be in Stockholm alignment format. There is a fairly good description of the Stockholm format rules at: http://en.wikipedia.org/wiki/Stockholm_format. Infernal will use the sequence and secondary structural information to align the candidate sequences to the full reference alignment. Similar to PyNAST, Infernal will not allow for gaps to be inserted into the reference alignment. Using Infernal is slower than other methods, and therefore is best used with sequences that do not align well using PyNAST.

The following command can be used for aligning sequences using the Infernal method, where we supply the program with a FASTA file of unaligned sequences, a STOCKHOLM file of pre-aligned sequences and secondary structure (this is the template file - an example file can be obtained from: http://bmf.colorado.edu/QIIME/seed.16s.reference_model.sto.zip), and the results will be written to the directory "infernal_aligned/"
 align_seqs.py -m infernal -i repr_set_seqs.fasta -t seed.16s.reference_model.sto -o infernal_aligned/

Options:
  --version             show program's version number and exit
  -h, --help            show this help message and exit
  -v, --verbose         Print information during execution -- useful for
                        debugging [default: False]
  -t TEMPLATE_FP, --template_fp=TEMPLATE_FP
                        Filepath for template against [REQUIRED if -m pynast
                        or -m infernal]
  -m ALIGNMENT_METHOD, --alignment_method=ALIGNMENT_METHOD
                        Method for aligning sequences. Valid choices are:
                        pynast, infernal, clustalw, muscle, infernal, mafft
                        [default: pynast]
  -a PAIRWISE_ALIGNMENT_METHOD, --pairwise_alignment_method=PAIRWISE_ALIGNMENT_METHOD
                        method for performing pairwise alignment in PyNAST.
                        Valid choices are muscle, pair_hmm, clustal, blast,
                        uclust, mafft [default: uclust]
  -d BLAST_DB, --blast_db=BLAST_DB
                        Database to blast against when -m pynast [default:
                        created on-the-fly from template_alignment]
  -o OUTPUT_DIR, --output_dir=OUTPUT_DIR
                        Path to store result file [default:
                        <ALIGNMENT_METHOD>_aligned]
  -e MIN_LENGTH, --min_length=MIN_LENGTH
                        Minimum sequence length to include in alignment
                        [default: 150]
  -p MIN_PERCENT_ID, --min_percent_id=MIN_PERCENT_ID
                        Minimum percent sequence identity to closest blast hit
                        to include sequence in alignment [default: 0.75]

  REQUIRED options:
    The following options must be provided under all circumstances.

    -i INPUT_FASTA_FP, --input_fasta_fp=INPUT_FASTA_FP
                        path to the input fasta file [REQUIRED]

cd /sw/qiime/Qiime/1.3.0/qiime/support_files/denoiser/FlowgramAlignment
make 2>&1 |tee make_FlowgramAlignment.txt
make install |tee make_install_FlowgramAlignment.txt

#PBS -m abe
#PBS -M <youremail>@griffith.edu.au
#PBS -N qiimeOpenMPI
#PBS -l select=2:ncpus=3:mem=12g:mpiprocs=3

source $HOME/.bashrc
module load qiime/1.3.0

WORK_DIR=/export/home/snumber/pbs/qiime
HOME_DIR=/export/home/snumber/
echo "Starting job"

## The number of nodes is given by the select =<NUM > above
NODES=1

###$PBS_NODEFILE is a node-list file created with select and mpiprocs options by PBS
###### The number of MPI processes available is mpiprocs * nodes (=NPROCS)
NPROCS=6


mpirun --prefix /sw/openMPI/1.4.3-gnu/ -machinefile $PBS_NODEFILE -np $NPROCS env PATH=$PATH:$SWORK_DIR:$HOME_DIR env LD_LIBRARY_PATH=$LD_LIBRARY_PATH make_otu_heatmap_html.py -i otus/otu_table.txt -o otus/OTU_Heatmap/



echo "Done with job"

#!/bin/bash
#PBS -N QIIME
#PBS -m abe
#PBS -M YourEmail@griffith.edu.au
#PBS -l select=1:ncpus=2:mem=14gb -l walltime=100:00:00
module load qiime/1.5.0
export FEKO_USER_HOME=/export/home/s12345/pbs/feko
source $HOME/.bashrc
echo "Starting job: "
pick_otus_through_otu_table.py -i /export/home/s12345/pbs/qiime/seq.fasta  -o /export/home/s12345/pbs/qiime/otus/

>34
TGGCACGTGCGATGGCAGTTCAACGTTCA
>23
TAAATCCCGTAGGCTTTTAGCATCGACG
>2
TTATTCGAAGCGCTTTACGACACGCGCGCA

module load qiime/1.5.0

OR:

module load python/2.7.1
module load qiime/1.3.0
module load bioinformatics/uclust/1.2.22
module load bioinformatics/fasttree/2.1.3
module load bioinformatics/rdpclassifier/2.3
module load R/2.13.0
module load blast/2.2.25
module load bioinformatics/cd-hit/4.5.4
module load bioinformatics/cdbfasta/0.99
module load bioinformatics/chimeraslayer/r20110519
module load bioinformatics/mothur/1.21.1
module load bioinformatics/clearcut/1.0.9
module load bioinformatics/raxml/7.2.8a-mpi #(other versions available)
module load bioinformatics/infernal/1.0.2-mpi #(OR  module load bioinformatics/infernal/1.0.2-serial)
module load bioinformatics/mafft/6.857 # (OR: module load bioinformatics/mafft/6.857-extensions)
module load bioinformatics/muscle/3.8.31
module load gsl/gsl-1.15
module load bioinformatics/greengenes/gg
module load bioinformatics/ampliconnoise/1.25
module load bioinformatics/ghc/7.0.3
module load cytoscape/2.8.1
module load mpi/openMPI/1.4.3-gnu #(optional)
module load qiime/1.5.0

cd /sw/qiime/biom/0.9.3/src/biom-format-0.9.3
module load python/2.7.1
module load bioinformatics/uclust/1.2.22
module load bioinformatics/fasttree/2.1.3
module load bioinformatics/rdpclassifier/2.3
module load R/2.13.0
module load blast/2.2.25
module load bioinformatics/cd-hit/4.5.4
module load bioinformatics/cdbfasta/0.99
module load bioinformatics/chimeraslayer/r20110519
module load bioinformatics/mothur/1.21.1
module load bioinformatics/clearcut/1.0.9
module load bioinformatics/raxml/7.2.8a-mpi #(other versions available)
module load bioinformatics/infernal/1.0.2-mpi #(OR  module load bioinformatics/infernal/1.0.2-serial)
module load bioinformatics/mafft/6.857 # (OR: module load bioinformatics/mafft/6.857-extensions)
module load bioinformatics/muscle/3.8.31
module load gsl/gsl-1.15
module load bioinformatics/greengenes/gg
module load bioinformatics/ampliconnoise/1.25
module load bioinformatics/ghc/7.0.3
module load cytoscape/2.8.1
module load mpi/openMPI/1.4.3-gnu #(optional)
module load qiime/1.5.0

python setup.py install 

mkdir /sw/qiime/Qiime/1.5.0/
cd /sw/qiime/Qiime/1.5.0/
tar -zxvf Qiime-1.5.0.tar.gz
cp /sw/qiime/Qiime/1.5.0/src/Qiime-1.5.0/qiime/support_files/qiime_config /sw/qiime/Qiime/1.5.0/.qiime_config

Find the line beginning qiime_scripts_dir and add a tab, followed by the QIIME scripts directory (/sw/qiime/Qiime/1.5.0/bin)

cd /sw/qiime/Qiime/1.5.0/src/Qiime-1.5.0
mv * /sw/qiime/Qiime/1.5.0/

cd /sw/qiime/Qiime/1.5.0
python setup.py install --install-scripts=/sw/qiime/Qiime/1.5.0/bin 2>&1 |tee qiime_installLOG.txt

>>>>>>>>>>>>>
You need to make sure that the install-data path points to the same place as the purelib path, e.g:

python setup.py install --install-scripts=/sw/qiime/Qiime/1.5.0/bin/ --install-purelib=/sw/qiime/Qiime/1.5.0/lib/ --install-data=/sw/qiime/Qiime/1.5.0/lib/

Temporarily fixed as the above sysntax was not used in the install as follows:

mkdir /sw/python/2.7.1/lib/python2.7/site-packages/qiime/support_files/denoiser/bin
cp -i  /sw/qiime/Qiime/1.5.0/qiime/support_files/denoiser/bin/FlowgramAli_4frame /sw/python/2.7.1/lib/python2.7/site-packages/qiime/support_files/denoiser/bin/

>>>>>>>>>>>>>

CHECK for errors: 
cd /sw/qiime/Qiime/1.5.0/bin
python print_qiime_config.py -t

more .qiime_config 
# qiime_config
# WARNING: DO NOT EDIT OR DELETE Qiime/qiime_config
# To overwrite defaults, copy this file to $HOME/.qiime_config or a full path
# specified by $QIIME_CONFIG_FP and edit that copy of the file.

cluster_jobs_fp	/sw/qiime/Qiime/1.5.0/bin/start_parallel_jobs.py
python_exe_fp	python
working_dir     None
blastmat_dir
blastall_fp	blastall
pynast_template_alignment_fp	/sw/qiime/greengenes/core_set_aligned.fasta.imputed
pynast_template_alignment_blastdb
template_alignment_lanemask_fp	/sw/qiime/greengenes/lanemask_in_1s_and_0s
jobs_to_start	1
seconds_to_sleep	60
qiime_scripts_dir	/sw/qiime/Qiime/1.5.0/bin
temp_dir                /tmp
denoiser_min_per_core	50
cloud_environment	False
topiaryexplorer_project_dir
torque_queue	workq

                     blastmat_dir      None
                         sc_queue      all.q
      topiaryexplorer_project_dir      None
     pynast_template_alignment_fp      /export/home/s123456/install/QIIME/data/gg_otus_4feb2011/rep_set/gg_97_otus_4feb2011_aligned.fasta
                  cluster_jobs_fp      /export/home/s123456/Install/QIIME/bin/start_parallel_jobs.py
pynast_template_alignment_blastdb      /export/home/s123456/install/QIIME/data/core_set_aligned.fasta.imputed
assign_taxonomy_reference_seqs_fp      None
                     torque_queue      workq
              qiime_test_data_dir      None
   template_alignment_lanemask_fp      /export/home/s123456/install/QIIME/data/lanemask_in_1s_and_0s
                    jobs_to_start      10
                cloud_environment      False
                qiime_scripts_dir      /export/home/s123456/Install/QIIME/bin
            denoiser_min_per_core      50
                      working_dir      None
                    python_exe_fp      python
                         temp_dir      /tmp
                      blastall_fp      blastall
                 seconds_to_sleep      60
assign_taxonomy_id_to_taxonomy_fp      None