...
If you wish to use that, simply do this:
cp /sw/qiime/Qiime/.qiime_config ~/
cp /sw/qiime/Qiime/1.5.0/.qiime_config ~/
OR if version specific:
cp /sw/qiime/Qiime/1.9.1/qiime_config ~/
Modify it to suit you.
| No Format |
|---|
cat ~/.qiime_config # qiime_config # WARNING: DO NOT EDIT OR DELETE Qiime/qiime_config # To overwrite defaults, copy this file to $HOME/.qiime_config or a full path # specified by $QIIME_CONFIG_FP and edit that copy of the file. cluster_jobs_fp /sw/qiime/Qiime/1.5.0/bin/start_parallel_jobs.py python_exe_fp python working_dir blastmat_dir /sw/bioinformatics/ncbi/2009.3/ncbi/data blastall_fp blastall pynast_template_alignment_fp /sw/qiime/greengenes/core_set_aligned.fasta.imputed pynast_template_alignment_blastdb template_alignment_lanemask_fp /sw/qiime/greengenes/lanemask_in_1s_and_0s jobs_to_start 1 seconds_to_sleep 60 qiime_scripts_dir /sw/qiime/Qiime/1.5.0/bin #qiime_scripts_dir /sw/qiime/Qiime/1.5.0/bin temp_dir /tmp denoiser_min_per_core 50 cloud_environment False topiaryexplorer_project_dir torque_queue workq sc_queue all.q topiaryexplorer_project_dir assign_taxonomy_reference_seqs_fp qiime_test_data_dir |
...
| No Format |
|---|
module load qiime/1.5.0
module load qiime/1.9.1 |
Testing
| No Format |
|---|
module load qiime/1.5.0
print_qiime_config.py -t
print_qiime_config.py -t
System information
==================
Platform: linux2
Python version: 2.7.1 (r271:86832, Jun 29 2011, 09:08:45) [GCC 4.4.5 20110214 (Red Hat 4.4.5-6)]
Python executable: /sw/python/2.7.1/bin/python
Dependency versions
===================
PyCogent version: 1.5.1
NumPy version: 1.5.1
matplotlib version: 1.1.0
biom-format version: 0.9.3
QIIME library version: 1.5.0
QIIME script version: 1.5.0
PyNAST version (if installed): 1.1
RDP Classifier version (if installed): rdp_classifier-2.3.jar
QIIME config values
===================
blastmat_dir: /sw/bioinformatics/ncbi/2009.3/ncbi/data
sc_queue: all.q
topiaryexplorer_project_dir: None
pynast_template_alignment_fp: /sw/qiime/greengenes/core_set_aligned.fasta.imputed
cluster_jobs_fp: /sw/qiime/Qiime/1.5.0/bin/start_parallel_jobs.py
pynast_template_alignment_blastdb: None
assign_taxonomy_reference_seqs_fp: None
torque_queue: workq
qiime_test_data_dir: None
template_alignment_lanemask_fp: /sw/qiime/greengenes/lanemask_in_1s_and_0s
jobs_to_start: 1
cloud_environment: False
qiime_scripts_dir: /sw/qiime/Qiime/1.5.0/bin
denoiser_min_per_core: 50
working_dir: None
python_exe_fp: python
temp_dir: /tmp
blastall_fp: blastall
seconds_to_sleep: 60
assign_taxonomy_id_to_taxonomy_fp: None
running checks:
test_FastTree_supported_version (__main__.Qiime_config)
FastTree is in path and version is supported ... ok
test_INFERNAL_supported_version (__main__.Qiime_config)
INFERNAL is in path and version is supported ... ok
test_ParsInsert_supported_version (__main__.Qiime_config)
ParsInsert is in path and version is supported ... ok
test_R_supported_version (__main__.Qiime_config)
R is in path and version is supported ... ok
test_ampliconnoise_install (__main__.Qiime_config)
AmpliconNoise install looks sane. ... ok
test_blast_supported_version (__main__.Qiime_config)
blast is in path and version is supported ... ok
test_blastall_fp (__main__.Qiime_config)
blastall_fp is set to a valid path ... ok
test_blastmat_dir (__main__.Qiime_config)
blastmat_dir is set to a valid path. ... ok
test_cdbtools_supported_version (__main__.Qiime_config)
cdbtools is in path and version is supported ... ok
test_cdhit_supported_version (__main__.Qiime_config)
cd-hit is in path and version is supported ... ok
test_chimeraSlayer_install (__main__.Qiime_config)
no obvious problems with ChimeraSlayer install ... ok
test_clearcut_supported_version (__main__.Qiime_config)
clearcut is in path and version is supported ... ok
test_cluster_jobs_fp (__main__.Qiime_config)
cluster_jobs_fp is set to a valid path and is executable ... ok
test_denoiser_supported_version (__main__.Qiime_config)
denoiser aligner is ready to use ... ok
test_for_obsolete_values (__main__.Qiime_config)
local qiime_config has no extra params ... ok
test_matplotlib_suported_version (__main__.Qiime_config)
maptplotlib version is supported ... ok
test_mothur_supported_version (__main__.Qiime_config)
mothur is in path and version is supported ... ok
test_muscle_supported_version (__main__.Qiime_config)
muscle is in path and version is supported ... ok
test_numpy_suported_version (__main__.Qiime_config)
numpy version is supported ... ok
test_pplacer_supported_version (__main__.Qiime_config)
pplacer is in path and version is supported ... ok
test_pynast_suported_version (__main__.Qiime_config)
pynast version is supported ... ok
test_pynast_template_alignment_blastdb_fp (__main__.Qiime_config)
pynast_template_alignment_blastdb, if set, is set to a valid path ... ok
test_pynast_template_alignment_fp (__main__.Qiime_config)
pynast_template_alignment, if set, is set to a valid path ... ok
test_python_exe_fp (__main__.Qiime_config)
python_exe_fp is set to a working python env ... ok
test_python_supported_version (__main__.Qiime_config)
python is in path and version is supported ... ok
test_qiime_scripts_dir (__main__.Qiime_config)
qiime_scripts_dir, if set, is set to a valid path ... ok
test_qiime_test_data_dir (__main__.Qiime_config)
qiime_test_data_dir, if set, is set to a valid path ... ok
test_raxmlHPC_supported_version (__main__.Qiime_config)
raxmlHPC is in path and version is supported ... ok
test_rtax_supported_version (__main__.Qiime_config)
rtax is in path and version is supported ... ok
test_temp_dir (__main__.Qiime_config)
temp_dir, if set, is set to a valid path ... ok
test_template_alignment_lanemask_fp (__main__.Qiime_config)
template_alignment_lanemask, if set, is set to a valid path ... ok
test_uclust_supported_version (__main__.Qiime_config)
uclust is in path and version is supported ... ok
test_usearch_supported_version (__main__.Qiime_config)
usearch is in path and version is supported ... ok
test_working_dir (__main__.Qiime_config)
working_dir, if set, is set to a valid path ... ok
----------------------------------------------------------------------
Ran 34 tests in 0.318s
OK
|
...
| No Format |
|---|
#PBS -m abe #PBS -M <youremail>@griffith.edu.au #PBS -N qiimeOpenMPI #PBS -l select=2:ncpus=3:mem=12g:mpiprocs=3 source $HOME/.bashrc module load qiime/1.3.0 WORK_DIR=/export/home/snumber/pbs/qiime HOME_DIR=/export/home/snumber/ echo "Starting job" ## The number of nodes is given by the select =<NUM > above NODES=1 ###$PBS_NODEFILE is a node-list file created with select and mpiprocs options by PBS ###### The number of MPI processes available is mpiprocs * nodes (=NPROCS) NPROCS=6 mpirun --prefix /sw/openMPI/1.4.3-gnu/ -machinefile $PBS_NODEFILE -np $NPROCS env PATH=$PATH:$SWORK_DIR:$HOME_DIR env LD_LIBRARY_PATH=$LD_LIBRARY_PATH make_otu_heatmap_html.py -i otus/otu_table.txt -o otus/OTU_Heatmap/ echo "Done with job" |
Another Sample PBS script
| No Format |
|---|
#!/bin/bash
#PBS -N QIIME
#PBS -m abe
#PBS -M YourEmail@griffith.edu.au
#PBS -l select=1:ncpus=2:mem=14gb -l walltime=100:00:00
module load qiime/1.5.0
export FEKO_USER_HOME=/export/home/s12345/pbs/feko
source $HOME/.bashrc
echo "Starting job: "
pick_otus_through_otu_table.py -i /export/home/s12345/pbs/qiime/seq.fasta -o /export/home/s12345/pbs/qiime/otus/ |
An example seq.fasta file
| No Format |
|---|
>34
TGGCACGTGCGATGGCAGTTCAACGTTCA
>23
TAAATCCCGTAGGCTTTTAGCATCGACG
>2
TTATTCGAAGCGCTTTACGACACGCGCGCA |
Version 1.5.0
Usage
| No Format |
|---|
module load qiime/1.5.0 OR: module load python/2.7.1 module load qiime/1.3.0 module load bioinformatics/uclust/1.2.22 module load bioinformatics/fasttree/2.1.3 module load bioinformatics/rdpclassifier/2.3 module load R/2.13.0 module load blast/2.2.25 module load bioinformatics/cd-hit/4.5.4 module load bioinformatics/cdbfasta/0.99 module load bioinformatics/chimeraslayer/r20110519 module load bioinformatics/mothur/1.21.1 module load bioinformatics/clearcut/1.0.9 module load bioinformatics/raxml/7.2.8a-mpi #(other versions available) module load bioinformatics/infernal/1.0.2-mpi #(OR module load bioinformatics/infernal/1.0.2-serial) module load bioinformatics/mafft/6.857 # (OR: module load bioinformatics/mafft/6.857-extensions) module load bioinformatics/muscle/3.8.31 module load gsl/gsl-1.15 module load bioinformatics/greengenes/gg module load bioinformatics/ampliconnoise/1.25 module load bioinformatics/ghc/7.0.3 module load cytoscape/2.8.1 module load mpi/openMPI/1.4.3-gnu #(optional) module load qiime/1.5.0 |
...
1. https://groups.google.com/forum/?fromgroups=#!topic/qiime-forum/HAWoYltmS68
2. https://github.com/biocore/qiime/blob/1.5.0/scripts/start_parallel_jobs.py
3. https://github.com/biocore/qiime